Principles of Biochemistry, Volume 3 - A. Lehninger 1985

Molecular Mechanisms of Genetic Information Transfer
Protein Synthesis and Its Regulation
Chapter Summary

To participate in Protein Synthesis, Amino Acids are first activated in the Cytosol by specific Aminoacyl-tRNA synthetases. These Enzymes catalyze The formation of an ester bond between the aminoacyl residue and the corresponding tRNA, accompanied by the Cleavage of ATP to AMP and pyrophosphate. tRNAs contain from 73 to 93 nucleotide residues, some of which include modified bases. tRNA molecules feature an acceptor arm with a terminal sequence (3')-CCA (to which The amino acid is attached via an ester bond) and an anticodon arm.

Class="center">

Fig. 29-28. Structure OF THE promoter-operator region of the E. coli lac Operon. The nucleotide sequence of both DNA strands is shown, starting from the last 15 bases of the regulatory (i) Gene and ending with the first nine bases of the z gene. It can be seen that the promoter overlaps the operator. The CAP-cAMP complex binding site consists of approximately 38 bases, and the initial RNA polymerase binding site consists of approximately 40 bases. The lac repressor binding site within the operator contains about 28 Base Pairs and exhibits twofold Symmetry.

The TψC arm and the dihydrouridine arm; some tRNAs contain a fifth, extra arm. A triplet of NUCLEOTIDES in the tRNA (a triplet) forming the anticodon is responsible for the Specificity of the interaction between the aminoacyl-tRNA and the complementary codon triplet in the mRNA. The growth of the polypeptide chain on Ribosomes begins with the N-terminal Amino Acid and continues through the sequential addition of new residues to the C-terminus. Prokaryotes contain 70S ribosomes, consisting of a large 50S and a small 30S subunit. Eukaryotic ribosomes are significantly larger and contain more Proteins than prokaryotic ones.

In Bacteria, the initiating N-terminal residue in all proteins is N-formylmethionyl-tRNA. It forms a complex with initiation factor 2 (IF-2), the 30S ribosomal subunit, mRNA, and GTP; this complex interacts with the 50S subunit to form the initiation complex with the simultaneous cleavage of GTP to GDP and the release of IF-2. The subsequent elongation steps require the presence of GTP and three elongation factors that participate in binding the incoming aminoacyl-tRNA to the aminoacyl-binding site of the ribosome (the A-site). During the peptidyl transferase reaction, the formylmethionine residue is transferred to the amino group of the newly arrived aminoacyl-tRNA. The peptidyl-tRNA, lengthened in this manner, moves from the aminoacyl site to the peptidyl site of the ribosome; this process requires GTP Hydrolysis. After multiple repetitions of such elongation cycles, Termination of the polypeptide chain occurs, mediated by so-called release factors. Protein synthesis takes place in polyribosomes—complexes consisting of several or A large number of ribosomes attached to an mRNA molecule; each ribosome reads the mRNA and synthesizes protein independently. At least four high-energy phosphate bonds are consumed for the formation of each peptide bond; this is presumably necessary to ensure The fidelity of Translation.

Codons for amino acids are specific triplets of nucleotides. The nucleotide sequence of the codons was established through experiments using synthetic mRNAs of known nucleotide composition and sequence. In METABOLISM/28.html">The Genetic Code, almost every amino acid corresponds to multiple code words. The third letter of each codon is much less specific than the first two, a phenomenon referred to as “wobble.” The standard words of the genetic code are presumably universal for all organisms, although codons whose meanings differ from the universal code have been found in human Cell/35.html">Mitochondria. The initiating amino acid N-formylmethionine is coded by the AUG codon, and its interaction with this codon requires an initiation signal on the 5' side of AUG with a high content of A and G. Triplets UAA, UGA, and UAG do not code for any amino acid; they serve as termination signals for the polypeptide chain. In some viral DNAs, the same nucleotide sequence can encode two different proteins, the mRNAs for which are transcribed using different reading frames.

Protein synthesis in prokaryotes is regulated primarily at the level of Introduction/24.html">DNA Transcription, i.e., at the level of mRNA formation. The transcription of a group of metabolically related genes is regulated by the attachment (or dissociation) of a specific protein—the repressor—to the operator region of the DNA. The operator and the group of associated genes together constitute an operon. The transcription of such a group of genes can be induced by a specific nutrient substrate, such as lactose. Lactose can bind the repressor and thereby cause its release from the operator. This permits the transcription of genes encoding proteins required by The Cell to utilize lactose as a source of carbon and energy. Some operons also possess a promoter region containing a regulatory part—the so-called CAP site; the latter is designed for binding the complex formed by the catabolite activator protein (CAP) and cAMP. This complex, which forms in the absence of glucose in the medium, enables RNA polymerase to attach to the Transcription initiation site of the genes responsible for lactose Catabolism.

References

Activation of amino acids

Rich A., Kim S. H. The Three-Dimensional Structure of Transfer RNA, Sci. Am., 238, 52-62, January 1978.

Schimmel P. R. Understanding the Recognition of Transfer RNAs by Aminoacyl Transfer Synthetases, Adv. Enzymol., 49, 187-222

(1979).

Ribosomes

Nomura M. Assembly of Bacterial Ribosomes, Science, 179, 864–873 (1973).

Wittman H. G. Structure and function of E. coli Ribosomes, Fed. Proc., 36, 2025–2080 (1977).

Stages of initiation, elongation, and termination of protein synthesis

Weissbach H., Pestka S. (eds.). MOLECULAR MECHANISMS OF Protein Biosynthesis, Academic, New York, 1977. Review articles on various aspects of protein synthesis.

Genetic Code

Barrell B. G., Air G.M., Hutchinson C. A., III. Overlapping Genes in Bacteriophage φX174, Nature, 264, 34-40 (1976).

Crick F. H. C. The Genetic Code III, Sci. Am., 215, 55-62, October 1966.

Fiddes J. C. The Nucleotide Sequence of a Viral DNA, Sci. Am., 237, 54-67, December 1977.

Hall B. D. Mitochondria Spring Surprises, Nature, 282, 129-130 (1979). Exceptions to THE PRINCIPLE OF the universality of the genetic code.

Nirenberg M. The Genetic Code II, Sci. Am., 208, 80-94, March 1963. Description of the first experiments on deciphering the genetic code.

Regulation of Gene Expression

Brown D. D. Gene Expression IN eukaryotes, Science, 211, 667-674 (1981).

Lewin B. Gene Regulation II, 2nd ed., Wiley, New York, 1980. The book contains a wealth of information on The problem of regulation in eukaryotes.

Maniatis T., Ptashne M. A DNA Operator-Repressor System, Sci. Am., 234, 64-76, January 1976.

O’Malley B. W. et al. The Ovalbumin Gene: Organization, Structure, Transcription, and Regulation, Recent Progr. Horm. Res., 35, 1-42 (1979).

Pastan I. Cyclic AMP, Sci. Am., 227, 97-105, August 1972.

Special Topics

Palade G. Intracellular Aspects of The process of Protein Synthesis, Science, 189, 347-357 (1975).

Yarus M. Accuracy of Translation, Progr. Nucleic Acid Res., 23, 195-225 (1979).

Questions and Problems

1. mRNA Translation. Predict the Amino Acid Sequence of Peptides synthesized in ribosomes in the presence of the following templates, assuming that reading begins from the first triplet at the left end.

a) GGUCAGUCGCUCCUGAUU

b) UUGGAUGCGCCAUAAUUUGCU

c) CAUGAUGCCUGUUGCUAC

d) AUGGACGAA

2. Is it possible to predict the nucleotide sequence of an mRNA based on the amino acid sequence of a polypeptide? A given nucleotide sequence in an mRNA encodes one and only one amino acid sequence in a polypeptide under a strictly defined reading frame. Is it possible, based on a given sequence of amino acid residues in a protein, such as cytochrome c, to predict the nucleotide sequence of the single mRNA encoding this protein? Justify your answer.

3. How many different mRNAs can encode a single amino acid sequence? As an additional illustration of the question considered in the previous problem, write all possible mRNA sequences capable of encoding the simple tripeptide Leu-Met-Tyr. By answering this question, you will gain some insight into the number of different mRNAs that can encode a single polypeptide.

4. Polypeptide encoding by double-stranded DNA. The transcribed strand of a double-stranded DNA contains the sequence

(5) CTTAACACCCCTGACTTCGCGCCGTCG

a) What mRNA sequence can be transcribed from this strand?

b) What amino acid sequence could be encoded by this sequence when read from the 5'-end?

c) Suppose that the other strand of this DNA is also transcribed, and the resulting mRNA is translated. Does the resulting amino acid sequence match the sequence you provided in the answer to question b)? Explain the Biological Significance of your Answers TO QUESTIONS b) and c).

5. Methionine corresponds to only one codon. Methionine is one of the Two amino acids that correspond to a single codon. This single methionine codon can encode both the initiating residue and internal methionine residues in Polypeptides synthesized by E. coli. Explain how this occurs.

6. Synthetic mRNAs. How would you synthesize a polyribonucleotide that could be used as an mRNA encoding predominantly phenylalanine residues and a small number of leucine and Serine residues? What Other Amino Acids, albeit in much smaller quantities, would be encoded by such a polyribonucleotide?

7. Direct energy costs in protein biosynthesis. Determine the minimum energy costs (calculated as the number of high-energy phosphate groups) required for The biosynthesis of the ß-globin chain of Hemoglobin (146 residues) from all amino acids, ATP, and GTP. Compare your answer with the Energy Expenditure for the biosynthesis of a linear Glycogen chain comprising 146 glucose residues linked by a(1→4) bonds and synthesized from glucose in the presence of ATP. Based on your answers, What is the additional energy cost of the ß-globin molecule due to the fact that, unlike glycogen, its construction requires the realization of specific Genetic information?

8. Indirect costs of protein synthesis. Along with the direct energy costs of protein synthesis considered in the previous question, the cell also incurs indirect energy costs associated with The production of biocatalysts required for protein synthesis. Compare the Factors Determining the indirect expenses that a Eukaryotic Cell must bear during the synthesis of linear a(1→4) glycogen chains and during polypeptide biosynthesis.

9. Predicting anticodons from codons. Most amino acids correspond to more than one codon, more than one tRNA, and more than one anticodon. Write all possible anticodons for the four Glycine codons: (5) GGU (3), GGC, GGA, and GGG.

a) Based on your answer, state which Features of the anticodon primarily determine its specificity in the case of glycine?

б) Which of the codon-anticodon pairs contain a "wobble" base pair?

в) In which of the codon-anticodon pairs are all three base pairs formed by strong Watson-Crick Hydrogen Bonds?

г) The Use of which codon-anticodon pair in biological Protein synthesis is the least probable? Why?

10. Unusual tRNA. A tRNA was recently discovered whose anticodon recognizes and binds to a tetranucleotide mRNA sequence. Predict how the participation of this unusual tRNA in polypeptide synthesis will affect the amino acid sequence.

11. How does a single-base change in mRNA affect the amino acid sequence of a polypeptide? Very important evidence confirming the correctness of the deciphered genetic code was obtained by studying The Nature of Mutations that lead to the substitution of a single residue in the protein amino acid sequence. Which of the Amino Acid Substitutions listed below is consistent with the genetic code? Which of the substitutions cannot be the result of a single-base change in the mRNA? Why?

а) Phe → Leu

б) Lys → Ala

в) Ala → Thr

г) Phe → Lys

д) Ile → Leu

е) His → Glu

ж) Pro → Ser

12. The cause of the mutation leading to Sickle cell anemia. In sickle cell hemoglobin, valine is found at the 6th position of the ß-globin chain instead of glutamic acid (which is present in normal hemoglobin A). What change occurring in the codon for glutamic acid led to its replacement by valine?