LEHNINGER PRINCIPLES OF BIOCHEMISTRY - VOL 3. INFORMATION PATHWAYS - 2017

PART III. INFORMATION PATHWAYS

27. PROTEIN METABOLISM

Questions and Problems

1. Translation of Messenger RNA.

Determine the Amino acid sequences of the Peptides synthesized by Ribosomes from the given mRNA sequences, assuming the reading frame begins with the first three bases in each sequence.

a) GGUСАGUСGСUССUGАUU

б) UUGGАUGСGССAUAАUUUGСU

в) САUGАUGССUGUUGСUАС

г) АUGGАСGАА

2. How many different mRNA sequences can correspond to a single Amino Acid Sequence?

Write out all possible mRNA sequences encoding the tripeptide Leu-Met-Tyr. Based on your answer, you can estimate how many mRNA variants can encode a single polypeptide.

3. Can an mRNA sequence be predicted from The amino acid sequence of its polypeptide product?

A given mRNA base sequence will encode one and only one amino acid sequence in a polypeptide, provided the reading frame is defined. Can you predict The base sequence of the unique mRNA encoding a protein, such as cytochrome c, solely from the known sequence of amino acid residues in that protein? Explain your reasoning.

4. Polypeptide coding by a DNA duplex.

The template strand of a DNA duplex region has the sequence

(5') CTTAACACCCCTGACTTCGCGCCGTCG (3')

a) What base sequence of mRNA can be transcribed from this strand?

б) What amino acid sequence can be encoded by the mRNA molecule you determined in part (a) (starting from the 5' end)?

в) If the complementary (non-template) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (б)? Explain the Biological Significance of your answer.

5. Methionine is specified by only a single codon.

Methionine is one of only Two Amino Acids specified by a single codon. How can the single methionine codon encode both the initial amino acid residue and internal methionine residues in peptides synthesized by E. coli Cells?

6. Synthetic mRNA molecules.

METABOLISM/28.html">The Genetic Code was deciphered using polyribonucleotides synthesized enzymatically or chemically in the laboratory. Given our current understanding of the genetic code, how would you synthesize a polyribonucleotide capable of serving as an mRNA that encodes A large number of Phe residues and relatively few Leu and Ser residues? What Other Amino Acids would this polyribonucleotide encode, albeit in even smaller amounts?

7. Energetic cost of Protein Biosynthesis.

Определите минимальную энергетическую стоимость (в эквивалентах АТР) биосинтеза β-цепи гемоглобина (146 остатков) при наличии всех необходимых аминокислот, АТР и GTP. Сравните результат с энергетическими затратами на Биосинтез линейной цепи гликогена из 146 остатков глюкозы, связанных α1 —> 4-связью, при наличии глюкозы, UTP и АТР (см. гл. 15 в т. 2). Исходя из полученного результата оцените дополнительные энергетические затраты на образование пептида, в котором все остатки выстраиваются в определенной последовательности, по сравнению с затратой энергии на синтез полисахарида, содержащего то же количество остатков, но не несущего информационного содержания?

In addition to the direct Energy Expenditure for Protein Synthesis, There are also indirect costs associated with producing the Enzymes required for the process. Compare the indirect energy costs incurred by a Introduction/5.html">Eukaryotic Cell in The biosynthesis of linear (α1 -> 4) Glycogen chains versus polypeptide biosynthesis, taking into account the number of enzymes involved.

8. Given the codons, determine the anticodons.

Most amino acids are encoded by multiple codons and bind to several tRNAs, each with its own anticodon. Write all possible anticodons for the four Glycine codons: (5’) GGU, GGC, GGA, and GGG.

a) Based on your answer, determine which positions in the anticodons are most important for identifying the corresponding codons in the case of glycine?

b) Which codon and anticodon bases form "wobble" pairs?

c) In which codon/anticodon pairs are all three positions bound by Watson-Crick Hydrogen Bonds?

9. Effect of a single nucleotide substitution on the amino acid sequence of a protein.

Much important Evidence for the genetic code was obtained by analyzing Changes in the amino acid sequence of mutant Proteins following the substitution of a single base in their genes. Which of the following Amino Acid Substitutions can be caused by a single-base substitution? Which changes cannot be caused by a single-base substitution? Why?

a) Phe —> Leu e) Ile —> Leu

b) Lys —> Ala f) His —> Glu

c) Ala —> Thr g) Pro —> Ser

d) Phe —> Lys

10. The cause of the sickle-cell mutation.

Sickle-cell Hemoglobin contains a Val residue at position 6 of the β chain instead of the Glu residue found in normal hemoglobin A. What change occurred in the glutamate codon that resulted in the substitution of Glu with Val?

11. The editing function of Aminoacyl-tRNA synthetases.

Isoleucyl-tRNA synthetase possesses editing activity that ensures The fidelity of aminoacylation, whereas histidyl-tRNA synthetase lacks such activity. Explain this observation.

12. The Significance of the "second genetic code".

Some aminoacyl-tRNA synthetases do not recognize or bind the anticodon of their corresponding tRNAs, and their binding Specificity relies on the recognition of other elements within the tRNA molecules. The tRNA for Alanine apparently belongs to this category.

a) What elements of tRNA^Ala are recognized by Ala-tRNA synthetase?

b) Describe the consequences of a C —> G substitution in the third position of the tRNA^Ala anticodon.

c) What other Selection/21.html">Types of Mutations might produce a similar effect?

d) Mutations of this type have not been found in natural populations of organisms. Why? Hint: Consider what might happen to individual proteins and to the Organism as a whole.

13. Fidelity of protein synthesis.

The chemical mechanisms ensuring the fidelity of protein synthesis differ from those ensuring the accuracy of DNA Replication. DNA polymerases possess a proofreading 3' —> 5' exonuclease activity that allows the removal of misincorporated bases from the growing DNA chain. Ribosomes lack a similar proofreading function, and amino acids delivered by tRNAs are never checked after incorporation. Hydrolyzing the peptide bond after an incorrect amino acid has already been incorporated into the growing polypeptide (by analogy with the proofreading step of DNA polymerases) would be energetically disadvantageous. Why? Hint: Recall how the linkage between the growing polypeptide and mRNA is maintained during elongation. See Fig. 27-20 and 27-30.

14. Prediction of Protein cellular localization.

A eukaryotic polypeptide Gene consisting of 300 amino acid residues is modified in such a way that the recognizable SRP signal sequence is located at the N-terminus of the polypeptide, while the nuclear localization signal (NLS) is internal, starting at position 150. In which cellular compartment is this protein likely to end up?

15. What is required for protein translocation across a membrane?

The secreted bacterial protein OmpA has a precursor, ProOmpA, which contains the N-terminal signal sequence required for secretion. If purified ProOmpA is denatured with 8 M urea and the urea is subsequently removed (for example, by rapidly passing the protein solution through a Gel filtration Column), the protein can be translocated across isolated inner bacterial membranes in vitro. However, translocation does not occur if ProOmpA is preincubated for several hours in the absence of urea. Furthermore, the translocation competence is maintained longer if ProOmpA is preincubated in the presence of another bacterial protein called the trigger factor. Describe the possible function of this factor.

16. Protein-coding capacity of viral DNA.

The Genome of bacteriophage φX174, consisting of 5,386 bp, encodes 10 proteins designated A through K, whose sizes are listed in the table below. How much DNA is required to code for these 10 proteins? How does the Genome Size of φX174 compare to the total volume of its coding sequences?

Analysis of Experimental Data

17. De novo protein design based on random gene sequences.

The Study of amino acid sequences and corresponding three-dimensional structures of natural and mutant proteins has provided considerable insight into the fundamental principles underlying protein folding. To test this knowledge, it is useful to design a protein based on these principles and check whether its three-dimensional Structure matches the predicted one.

Kamtekar and colleagues (1993) used their knowledge of the genetic code to design random protein sequences with a defined arrangement of hydrophilic and hydrophobic residues. Their approach to studying the determinants of Three-Dimensional Protein Structure was based on The properties of Amino Acids and the genetic code.

The researchers designed a series of simple proteins consisting of four α-helices (see below, right; α-helices are shown as cylinders) connected by unstructured loop regions (pink). Each α-Helix exhibited amphiphilic properties: on one side of the helix, the R-groups were exclusively hydrophobic (yellow), while on the other side they were exclusively hydrophilic (blue). It was hypothesized that a protein composed of four such helices, connected by irregular loop sequences, would form a three-dimensional structure in which the hydrophilic surfaces of the helices face the aqueous solution.

(a) What forces or interactions hold the four α-helices together in this bundle?

Figure 4-4, a (vol. 1) shows a 10-residue segment of an α-helix.

(b) Number the R-groups in Figure 4-4, a from top (N-terminus; 1) to bottom (C-terminus; 10). Which numbered R-groups project to the left, and which to the right?

(c) Suppose you need to design a 10-residue segment of an amphiphilic helix in which hydrophilic residues are located on the left and hydrophobic residues on the right. Propose a 10-amino-acid sequence that could form such a helix. Note that there may be multiple correct Answers to this question.

(d) Provide an example of a double-stranded DNA sequence that could encode the amino acid sequence you proposed in your answer to part (c). (This is an internal sequence, so there is no need to include a start codon or a stop codon.)

Kamtekar and colleagues synthesized proteins not with a specific sequence, but with a nearly random sequence in which hydrophobic and hydrophilic amino acid residues were positioned at specific sites. To achieve this, the researchers took advantage of fascinating Features of the genetic code, enabling them to generate a library of artificial DNA molecules with patterned, nearly random sequences.

To create a DNA sequence that would encode a random sequence of hydrophobic amino acid residues, the researchers started with a degenerate NTN codon, where N can be A, G, C, or T. To synthesize DNA molecules with various NUCLEOTIDES at the N position, they used an equimolar mixture of A, G, C, and T bases (see Fig. 8-35 in vol. 1). Similarly, to create a random sequence of polar amino acids, they started with a degenerate NAN codon and used an equimolar mixture of A, G, and C for synthesis (omitting T in this case).

(e) Which Amino acids can be encoded by the NTN triplet? Are all amino acids in this set hydrophobic? Does this set include all hydrophobic amino acids?

(f) Which amino acids can be encoded by the NAN triplet? Are they all polar? Does this set include all polar amino acids?

(g) Why should the reaction mixture not contain the T base during the synthesis of NAN codons?

Kamtekar and colleagues cloned the library of random DNA sequences into Plasmids, selected 48 variants with the correct arrangement of hydrophilic and hydrophobic amino acid residues, and expressed them in E. coli cells. The next step was to determine whether the folding of these proteins matched the predicted structure. Expressing and crystallizing each protein and subsequently determining its three-dimensional structure would have been overly laborious. Instead, the researchers used in vivo Processing in E. coli cells to screen out severely defective protein variants. Following this primary screening, they retained only those clones that exhibited a protein band of the expected molecular mass on SDS-Polyacrylamide gel Electrophoresis (see Fig. 3-18 in vol. 1).

(h) Why do proteins with severe structural defects fail to form a band of the expected molecular mass upon electrophoresis?

Several proteins passed this initial test, and further studies showed that they possessed the predicted four-helix bundle structure.

i) Why were not all random-sequence proteins that passed the initial screening able to form a four-helix structure?