Principles of Biochemistry, Volume 3 - A. Lehninger 1985

Molecular Mechanisms of Genetic Information Transfer
DNA Replication and Transcription
Chapter Summary

E. coli DNA replicates in a semi-conservative manner, such that each daughter double helix consists of one parental strand and one newly synthesized strand. The circular bacterial chromosome replicates bidirectionally from a single origin of Replication. Certain viral DNAs replicate via a rolling circle mechanism.

E. coli DNA polymerase I catalyzes DNA Synthesis from four deoxyribonucleoside-5'-triphosphates in the presence of Mg2+ ions, releasing pyrophosphate during the reaction. The chain grows in the 5'→3' direction. The reaction requires a pre-existing DNA strand that serves as both template and primer. The enzyme synthesizes a DNA strand complementary to the template strand; the polarity of the newly formed strand is opposite to that of the template. E. coli Cells contain three DNA polymerases. The primary replication enzyme is DNA polymerase III, whereas DNA polymerase I plays an accessory role in replication. One DNA strand (the leading strand) is replicated continuously in the 5'→3' direction, while the other strand (the lagging strand) is replicated discontinuously via short fragments known as Okazaki fragments. These fragments, which can be up to 2,000 NUCLEOTIDES long in prokaryotes, are synthesized in the direction opposite to the movement of the Replication fork. The formation of each Okazaki fragment begins with the synthesis of a short complementary RNA primer catalyzed by primase. DNA is then synthesized from the 3'-end of this RNA primer by DNA polymerase III. Following this, the RNA primer is excised and replaced with complementary DNA, which is subsequently joined to the lagging strand by DNA ligase. Replication also requires helicase and DNA-binding Proteins, which unwind the template and keep the DNA strands separated, assisting DNA polymerase in initiating its work. In addition, strand unwinding is facilitated by the Rotation of the DNA molecule performed by DNA gyrase. Following replication, DNA gyrase is also required for the formation of supercoiled DNA molecules. DNA polymerase I possesses both 3'→5' and 5'→3' exonuclease activities. The former serves for error correction—it excises mismatched nucleotides—whereas the latter activity ensures the removal of RNA primers from Okazaki fragments and participates in DNA Repair. DNA polymerase III also exhibits these exonucleolytic activities.

The process of METABOLISM/31.html">Transcription is catalyzed by DNA-dependent RNA polymerase, a complex enzyme that synthesizes an RNA strand complementary to one of the strands of double-stranded DNA using ribonucleoside-5'-triphosphates. To recognize the promoter region of DNA—that is, the signal for the initiation of RNA Synthesis—prokaryotic RNA polymerase requires a special σ (sigma) subunit. Many RNA strands can be transcribed simultaneously from a single Gene. rRNA and tRNA are produced from longer RNA precursors, which are trimmed by Nucleases and further modified enzymatically to mature molecules. Eukaryotic mRNAs are generated from larger precursors known as Heterogeneous nuclear RNAs (hnRNAs). Subsequently, they are modified by The addition of a long poly(A) tail to the 3'-end and a methylguanosine residue (a cap) to the 5'-end. Introns are removed with the assistance of Small nuclear RNAs (snRNAs).

In animal cells infected with oncogenic RNA Viruses, RNA-dependent DNA polymerases, also known as reverse transcriptases, are produced. These Enzymes transcribe the viral RNA chromosome to form complementary DNA. In this manner, Cancer-causing genes (oncogenes) can become integrated into The Genome of animal cells.

In bacterial cells infected with certain RNA viruses, RNA-dependent RNA replicases have been discovered. They exhibit Specificity toward the viral RNA template. Polynucleotide phosphorylase isolated from Bacteria can reversibly synthesize RNA-like polymers from ribonucleoside-5'-diphosphates. Although this enzyme is capable of adding ribonucleotides to the 3'-hydroxyl end of a polymer and removing them, it generally Functions in RNA degradation.

References

Replication

Alberts B., Sternglanz R. Recent Excitement in the DNA replication Problem, Nature, 269, 655-661 (1977). An excellent review of complex problems concerning DNA Replication and supercoiling, as well as the unwinding and fidelity of DNA strands.

Kornberg A. Aspects of DNA Replication, Cold Spring Harbor Symp. Quant. Biol., 43, 1-9 (1979). A review of the Current state of the DNA replication problem and formulation of new questions. This volume contains many valuable articles.

Kornberg A. DNA Replication, Freeman, San Francisco, Calif., 1980. The most up-to-date monograph on DNA replication, containing a comprehensive bibliography on the subject.

DNA Ligase

Lehman I.R. DNA Ligase: Structure,

Mechanism, Function, Science, 186, 790-797 (1974).

Transcription

Chamberlin M.J. RNA Polymerase: An Overview. In: Losick R. and Chamberlin M.J. (eds.), RNA Polymerase, pp. 17-67, Cold Spring Harbor Laboratory, New York, 1976.

Miller O. L., Jr. The Visualization of Genes in Action, Sci. Am., 228, 34-42, March 1973.

Pederson T. Messenger RNA Biosynthesis and Nuclear Structure, Am. Sci., 69 (1), 76-84 (1981).

Reverse Transcription

Temin H. RNA-Directed DNA Synthesis, Sci. Am., 226, 24-33, January 1972.

RNA Processing

Abelson J. RNA Processing and the Intervening Sequence Problem, Annu. Rev. Biochem., 48, 1035-1069 (1979).

Questions and Problems

1. Inferences from the Meselson-Stahl experiment. The results of the Meselson-Stahl experiment proved that DNA replication in E. coli proceeds via a semi-conservative mechanism. According to the so-called "dispersive" model, parental DNA strands are cleaved into fragments of random size during replication and then joined with fragments of newly synthesized DNA to form daughter duplexes in which both strands randomly contain both parental ("heavy") and daughter ("light") DNA. Explain why the Meselson-Stahl experiment ruled out this model.

2. Cairns' experiment.

a) Why did Cairns use radioactive thymidine when studying the course of DNA replication?

b) Could radioactive adenosine or guanosine have been used with equal success?

c) Show the enzymatic pathway by which radioactive thymidine is incorporated into E. coli DNA.

3. Turnover rate of the E. coli chromosome. How many complete revolutions around its axis must the E. coli chromosome make to unwind during replication?

4. Replication time in E. coli.

a) Based on the data provided in this chapter, calculate how long it takes to replicate the E. coli chromosome at 37°C if two replication forks move outward from THE ORIGIN OF replication.

b) Under certain conditions, E. coli cells can grow and divide with intervals as short as 20 min. Explain how this is possible.

5. Replication forks in E. coli and human cells.

a) What time is required to replicate an E. coli Ribonuclease gene (104 amino acid residues) if the replication fork moves at a rate of 750 Base Pairs per second?

b) The replication fork in a human Cell moves only 10 times slower than that in E. coli. What additional information do you need to calculate the minimum replication rate of a human gene encoding a protein of 104 amino acid residues?

6. Base pairing in replication and transcription.

a) Write The nucleotide sequence of the DNA segment synthesized by DNA polymerase on the DNA template given below, keeping in mind that nucleotide sequences are conventionally written in the 5'→3' direction.

(5) AGCTTGCAACGTTGCATTAG (3)

b) Now write the nucleotide sequence of the messenger RNA segment transcribed by RNA polymerase when using the newly synthesized DNA strand obtained in part (a) of this problem as a template.

7. Base composition of an RNA transcript. A DNA strand containing 105 nucleotide residues with a composition of A-21%, G-29%, C-29%, and T-21% is replicated by DNA polymerase to form a complementary strand. The resulting double-stranded DNA is then used as a template for RNA polymerase, which transcribes the new DNA strand. As a result, an RNA molecule of the same size as the template is synthesized.

a) Determine the Nucleotide Composition of the resulting RNA.

b) Suppose that RNA polymerase stops after transcribing only 2,000 residues of the new DNA strand. What will be the nucleotide COMPOSITION OF THE new short RNA?

8. Nucleotide composition of DNA synthesized on single-stranded templates. Determine the nucleotide composition of DNA synthesized on a template consisting of double-stranded circular phage φX174 DNA (i.e., the replicative form of this phage DNA), given that the nucleotide composition of one of its strands is: A-24.7%, G-24.1%, C-18.5%, and T-32.7%. What assumption must be made to solve this problem?

9. DNA-mRNA Hybridization. DNA hybridizes with mRNA transcribed from this DNA. How do you explain the fact that no more than 50% of total E. coli DNA can hybridize with all known mRNAs?

10. Okazaki fragments.

a) Approximately how many Okazaki fragments are formed during the replication of the E. coli chromosome?

b) What factors ensure the assembly of A large number of Okazaki fragments into new DNA in the correct order?

11. Leading and lagging strands. List the precursors and enzymes required for the Synthesis of the leading and lagging strands during DNA replication.

12. Fidelity of DNA replication.

a) What factors ensure replication fidelity during the synthesis of the leading DNA strand?

b) Would you expect the lagging strand to be synthesized with the same fidelity as the leading strand? Explain your answer.

13. Replication initiation. The DNA replicase system requires both a template and a primer for its functioning; moreover, it is unable to replicate intact circular DNA, except under special circumstances.

a) What is the Biological Significance of this property of the replicase system?

b) What might be the special circumstances under which the DNA replicase system is capable of replicating intact circular DNA?

14. Differences between RNA polymerase and polynucleotide phosphorylase. RNA polymerase requires nucleoside 5'-triphosphates as precursors for transcription and does not function with nucleoside 5'-diphosphates. Conversely, polynucleotide phosphorylase requires nucleoside 5'-diphosphates and does not work with 5'-triphosphates.

a) What is the reason for these differences between the two enzymes regarding their precursor requirements?

b) In light of your answer to part (a), indicate what other differences between these enzymes are relevant to the issue discussed.

15. Error correction. DNA polymerases can detect and correct errors, whereas RNA polymerases apparently lack this ability. Since an error in even a single base during either replication or transcription can lead to an error in Protein Synthesis, can you provide a biological explanation for this striking difference?



Last update: 06/08/2026

Editorial and Educational Adaptation: This material has been compiled based on the primary/original source text. The project team performed an editorial review, corrected technical inaccuracies, structured sections, and adapted the content for an educational format.

What was processed:

  • elimination of formatting defects (OCR errors, structural breaks, corrupted characters);
  • editorial organization of content;
  • standardization of terminology in accordance with academic sources;
  • verification of factual statements against the original source text.

All mentions of the author, publication year, and origin of the primary text have been preserved in accordance with the source.